RET exon 11 genotype in medullary thyroid cancer

Andrei Muresan; Serban Radian; Cristina Ghervan; Monica Gheorghiu; Diana Paun; Ionela Baciu; Dumitru Ioachim; Adriana Padure; Ruxandra Dobrescu; Dana Manda; Corin Badiu

doi:10.1530/endoabs.56.P1200

P1200

Prev Next

Section Contents Cite

Endocrine Abstracts (2018) 56 P1200 | DOI: 10.1530/endoabs.56.P1200

ECE2018 Poster Presentations: Thyroid Thyroid cancer (88 abstracts)

RET exon 11 genotype in medullary thyroid cancer

Andrei Muresan ¹ , Serban Radian ^1, , Cristina Ghervan ³ , Monica Gheorghiu ¹ , Diana Paun ¹ , Ionela Baciu ^1, , Dumitru Ioachim ¹ , Adriana Padure ¹ , Ruxandra Dobrescu ¹ , Dana Manda ¹ & Corin Badiu ¹

Views

Author affiliations

¹C. I. Parhon’ National Institute of Endocrinology, Bucharest, Romania; ²Carol Davila” University of Medicine and Pharmacy, Bucharest, Romania; ³Iuliu Hatieganu’ University of Medicine and Pharmacy, Bucharest, Romania.

Introduction: RET mutation is a well-known pathogenic event in medullary thyroid cancer. However, less than 25% of MTC cases present a germline mutation. First grade relatives of the patients with germline RET mutations may undergo genetic counselling and prophylactic appropriate therapeutic intervention.

Objective: The aim of the study was to evaluate the most frequent pathogenic RET exon 11 mutations and SNP in medullary thyroid cancer (MTC).

Patients and methods: A consecutive case series of 41 patients (30F, 11M) with confirmed MTC was submitted to genomic DNA sequencing for RET mutation. A number of 12 cases were included in familial syndromes (5 families), mostly MEN2A. Six of them were screened due to their affected relatives. Genomic DNA was isolated from EDTA-treated blood, using Promega Wizard Genomic DNA Purification Kit. Exon 11 of RET gene was amplified in a fragment of 419 bp, by polymerase chain reaction (PCR)using forward (ATACGCAGCCTGTACCCAGT) and reverse (CACAGGATGGCCTCTGTCTC) primers. Cycling conditions: 95° C for 7’, 35 cycles of 95° C for 10”/ 60° C for 20” and72° C for 6’. Purified amplicons were amplified again using only the forward primer (0.25 μM) and DTCS dye mix (40%) in a final volume of 10 μL, in 30 cycles of 96° C for 20”/58° C for 20” / 60° C for 3’. Purified sequencing extension products were analyzed on a CEQ-8000 Beckman Coulter genetic analyzer. Sequences were compared with the reference sequence NM_020975.4 and chromatograms were visuallyexamined for mutations using Sequence Investigator software.

Results: The 634 codon mutation was found in 7 patients (17.07%), all of them with MEN2A phenotype. The most frequent was Cys634Arg mutation (5 patients); other variants were Cys634Phe and Cys634Tyr. In one patient with sporadic MTC we found a SNP in codon 649 TCG634TTG with unknown significance. Another SNP, rs1799939 (2071 G/A) was present in 8 MTC cases and 4 healthy screened relatives (without 634 codon mutation).

Conclusion: In our study group RET exon 11 genotyping showed pathogenic mutation of codon 634 in 17.07% patients with MTC, all having MEN2A syndrome. None of sporadic MTC cases presented any pathogenic mutation in exon 11 of RET gene.