ECE2018 Poster Presentations: Thyroid Thyroid cancer (88 abstracts)
RET exon 11 genotype in medullary thyroid cancer
Andrei Muresan 1 , Serban Radian 1, , Cristina Ghervan 3 , Monica Gheorghiu 1 , Diana Paun 1 , Ionela Baciu 1, , Dumitru Ioachim 1 , Adriana Padure 1 , Ruxandra Dobrescu 1 , Dana Manda 1 & Corin Badiu 1
1C. I. Parhon’ National Institute of Endocrinology, Bucharest, Romania; 2Carol Davila” University of Medicine and Pharmacy, Bucharest, Romania; 3Iuliu Hatieganu’ University of Medicine and Pharmacy, Bucharest, Romania.
Introduction: RET mutation is a well-known pathogenic event in medullary thyroid cancer. However, less than 25% of MTC cases present a germline mutation. First grade relatives of the patients with germline RET mutations may undergo genetic counselling and prophylactic appropriate therapeutic intervention.
Objective: The aim of the study was to evaluate the most frequent pathogenic RET exon 11 mutations and SNP in medullary thyroid cancer (MTC).
Patients and methods: A consecutive case series of 41 patients (30F, 11M) with confirmed MTC was submitted to genomic DNA sequencing for RET mutation. A number of 12 cases were included in familial syndromes (5 families), mostly MEN2A. Six of them were screened due to their affected relatives. Genomic DNA was isolated from EDTA-treated blood, using Promega Wizard Genomic DNA Purification Kit. Exon 11 of RET gene was amplified in a fragment of 419 bp, by polymerase chain reaction (PCR)using forward (ATACGCAGCCTGTACCCAGT) and reverse (CACAGGATGGCCTCTGTCTC) primers. Cycling conditions: 95° C for 7’, 35 cycles of 95° C for 10”/ 60° C for 20” and72° C for 6’. Purified amplicons were amplified again using only the forward primer (0.25 μM) and DTCS dye mix (40%) in a final volume of 10 μL, in 30 cycles of 96° C for 20”/58° C for 20” / 60° C for 3’. Purified sequencing extension products were analyzed on a CEQ-8000 Beckman Coulter genetic analyzer. Sequences were compared with the reference sequence NM_020975.4 and chromatograms were visuallyexamined for mutations using Sequence Investigator software.
Results: The 634 codon mutation was found in 7 patients (17.07%), all of them with MEN2A phenotype. The most frequent was Cys634Arg mutation (5 patients); other variants were Cys634Phe and Cys634Tyr. In one patient with sporadic MTC we found a SNP in codon 649 TCG634TTG with unknown significance. Another SNP, rs1799939 (2071 G/A) was present in 8 MTC cases and 4 healthy screened relatives (without 634 codon mutation).
Conclusion: In our study group RET exon 11 genotyping showed pathogenic mutation of codon 634 in 17.07% patients with MTC, all having MEN2A syndrome. None of sporadic MTC cases presented any pathogenic mutation in exon 11 of RET gene.
Article tools
My recent searches
My recently viewed abstracts
Authors
Endocrine Abstracts
ISSN 1470-3947 (print) | ISSN 1479-6848 (online)
© Bioscientifica 2024 |
Privacy policy |
Cookie settings
BiosciAbstracts
Bioscientifica Abstracts is the gateway to a series of products that provide a permanent, citable record of abstracts for biomedical and life science conferences.
Find out more